Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 187429365 187434475 enh88806

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 187432108 rs66911837 AATTCCTGATCCCCAAAGGAATG A 7268119
chr3 187432108 rs67075041 AATTCCTGATCCCCAAAGGAATG A 7268120

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results