Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 112115685 112125355 enh25882

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 112116604 rs547735549 GCCCCCTTCAGTGCTCCTGCACCCACA G 11220023

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results