Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 112266465 112276875 enh25887

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 112273551 rs542426387 GATTCCTTCACCTAGGAGTTTA G 11221011

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr9 112273798 112273818 - hsa-miR-3927-5p MIMAT0022970 112273825 0.863119 0.0 260 1609