Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 113730185 113734335 enh115213

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 113732810 rs540487964 TCTTTATTCATATGATATGAATAAAGGG T 11230717

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results