Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 114046585 114053355 enh25907

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 114052840 rs533979969 GCCATTTATGGTATCATAATGGACTAA G 11232398

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results