EnhancerDB
  1. Home
  2. TFBS
  3. IRF1[chr9:115906634-115906655]
Chromosome characteristics of IRF1[chr9:115906634-115906655]
Back to top
Enhancers possibly regulated by IRF1[chr9:115906634-115906655]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 115890805 115908175 enh25919
Liver (HepG2) Placenta Peripheral Blood (MM.1S) Lung (PC-9) Epithelial (MCF-7)
SNP sites on IRF1[chr9:115906634-115906655]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 115906634 rs10981646 A T 11242303
chr9 115906639 rs55792126 GCTTCTTCTTTCTTC G 11242304
chr9 115906639 rs575208937 GCTTCTTCTTTCTTCCTTCTC G 11242305
chr9 115906639 rs72204415 GCTTCTTCTTTCTTC G 11242306
Genes possibly regulated by IRF1[chr9:115906634-115906655]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by IRF1[chr9:115906634-115906655]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results