Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 115890805 115908175 enh25919

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 115906639 rs55792126 GCTTCTTCTTTCTTC G 11242304
chr9 115906639 rs575208937 GCTTCTTCTTTCTTCCTTCTC G 11242305
chr9 115906639 rs72204415 GCTTCTTCTTTCTTC G 11242306

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results