Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 190017485 190022636 enh77174

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 190018004 rs574702573 G GCTGCAACTTTCTAGTTAAAGCCACACTTTTAA 7289976

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results