Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 117195105 117199355 enh94787

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 117198364 rs575493215 AAAGCCTTAAATGCATACTGCTAAGGGGAGG A 11249150

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results