Chrom Start End Enhancer ID Tissues that enhancer appears More
chr9 117551685 117565815 enh10924

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr9 117565022 rs539954283 ACTGGTATAGTTGTGGTAATAGTTTTCTC A 11251821

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr9 117546915 117568406 - TNFSF15 ENSG00000181634.7 117568406 0.93 0.91 3384 9264


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results