Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 190820190 190826643 enh61123

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 190825509 rs141064256 TGCTCCAGCTCCAGCTGCTCCA T 7294562
chr3 190825509 rs555301969 TGCTCCAGCTCCAGCTGCTCCA T 7294563

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results