| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr3 | 191189425 | 191196455 | enh108924 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr3 | 191195960 | rs11270568 | G | GTTTTTTGTTTTTTGTTTTGC | 7296603 | |
| chr3 | 191195960 | rs371156962 | G | GC,GTTTTGC,GTTTTTTGTTTTTTGTTTTGC | 7296604 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|