Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 191189425 191196455 enh108924

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 191195960 rs11270568 G GTTTTTTGTTTTTTGTTTTGC 7296603
chr3 191195960 rs371156962 G GC,GTTTTGC,GTTTTTTGTTTTTTGTTTTGC 7296604

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results