Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 114485 123535 enh7830

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 123295 rs377189390 CTGCTGATTGGTGCATTTTACAGAG C 7340096
chr4 123295 rs544143139 CTGCTGATTGGTGCATTTTACAGAG C 7340097

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results