Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 711979 724256 enh21303

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 712971 rs529418159 TGACCTTGTGATCTGCCTGCCTG T 7341552
chr4 712975 rs535336143 C G 7341553

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results