Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 1296679 1303210 enh63264

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 1299544 rs560617337 CACGTGCGCACGCGTGCGTGT C 7345643

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results