Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 1352405 1365615 enh88813

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 1353620 rs113121638 TCAGTGGGCTCCAGGATGCAGCTGA T 7346070
chr4 1353620 rs6148274 TCAGTGGGCTCCAGGATGCAGCTGA T 7346071

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results