Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 1511407 1517257 enh86505

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 1515837 rs558762600 GGATGATGGTGGTGGTGATGGT G 7346697
chr4 1515848 rs371406146 G A 7346698

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results