Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 2565385 2569535 enh95650

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 2567386 rs539138413 AACATGAGAAATGGGTTCACC A 7352989

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results