EnhancerDB
  1. Home
  2. TFBS
  3. RREB1[chr4:3370420-3370440]
Chromosome characteristics of RREB1[chr4:3370420-3370440]
Back to top
Enhancers possibly regulated by RREB1[chr4:3370420-3370440]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 3367212 3371574 enh115826
Brain (SK-N-SH)
SNP sites on RREB1[chr4:3370420-3370440]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 3370434 rs147564182 T TG 7357213
chr4 3370434 rs539344155 T TG,TGGGGGTGCCTGTGTGTGTTG 7357214
chr4 3370434 rs58838586 T TG 7357215
Genes possibly regulated by RREB1[chr4:3370420-3370440]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RREB1[chr4:3370420-3370440]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results