Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 5883345 5888875 enh7859

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 5884957 rs527641061 G GCTTTCCTTCCTTCCTTCCAT 7373562
chr4 5884963 rs545422610 C CTTCCTTCCTTCCATCT 7373563
chr4 5884971 rs112266764 C CTTCCATCT 7373564

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results