Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 6872365 6878344 enh7865

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 6875344 rs373049113 ATTAGTTAGTAAAGAATCCAGTTTCACCTC A 7380929
chr4 6875344 rs538952172 ATTAGTTAGTAAAGAATCCAGTTTCACCTC A 7380930
chr4 6875346 rs552758250 TAGTTAGTA T 7380931

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results