Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 8167185 8175855 enh21354

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 8168367 rs553475304 TCATCCACCCATCCATTCACCACC T 7394598

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr4 8007074 8007094 - hsa-miR-95-5p MIMAT0026473 8160539 0.90031 0.676023 7815 1229