Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 81922526 81927354 enh54783

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 81925893 rs6148544 CCTCACTTTAAGACATCCTGA C 7643468
chr4 81925894 rs202142605 C A,T 7643469

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results