Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 82902273 82907495 enh61188

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 82902504 rs138612520 A ACTGGAGGTGAAACCACTACCAGGG 7647609
chr4 82902504 rs55716092 A ACTGGAGGTGAAACCACTACCAGGG 7647610

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results