Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 648945 656215 enh47911

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 653418 rs565327533 TGCCGGAAGATTGAATGCGGAGC T 4247566

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results