Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 890265 894475 enh75741

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 893389 rs376144080 C CCTTGCTGGGTCTTGCTGGGT 4250140
chr16 893389 rs74275779 C CCTTGCTGGGTCTTGCTGGGT 4250141

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results