Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 1171945 1177784 enh52190

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 1173364 rs553988261 G A 4253104
chr16 1173365 rs565278176 TGCGCCTTCACCTCCGGCCTCCCGC T 4253105
chr16 1173368 rs113637184 G A,C 4253106

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results