Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 1947689 1952655 enh52191

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 1950538 rs111249901 GGCCGAAGGGACATGGCAGCAGCA G 4258462
chr16 1950538 rs372459112 GGCCGAAGGGACATGGCAGCAGCA G 4258463

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results