Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 1956360 1960534 enh115603

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 1957567 rs146472510 CCATGCCCCGGGCAGAGAGG C 4258568
chr16 1957567 rs367863444 CCATGCCCCGGGCAGAGAGG C 4258569
chr16 1957576 rs528181438 G A 4258570

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results