Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 2518153 2531971 enh91090

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 2518331 rs571661737 CCCTCCCTCCCTCTCTGCTTTCCCTCT C 4261856
chr16 2518333 rs187748199 C T 4261857

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 2521500 2524146 + NTN3 ENSG00000162068.1 2521500 0.92 0.99 3149 14439


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 2514012 2514035 + hsa-miR-6768-3p MIMAT0027437 2510109 0.0 0.0 8221 593