Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 106111129 106121235 enh63345

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 106117534 rs554144252 GTGATGTAGAATTCTTGGGGA G 7728513

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results