Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 107183442 107193115 enh54903

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 107186664 rs146718474 GGAGAGAGAGAGATCCAGAGATCCAAA G 7731867
chr4 107186664 rs746477788 GGAGAGAGAGAGATCCAGAGATCCAAA G 7731868

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results