| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr4 | 108286805 | 108290955 | enh105722 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr4 | 108288376 | rs142530939 | ACAACATCTAAAATTTATTTGGAGTACCTATGT | A | 7734646 | |
| chr4 | 108288376 | rs373151933 | ACAACATCTAAAATTTATTTGGAGTACCTATGT | A | 7734647 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|