Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 108286805 108290955 enh105722

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 108288376 rs142530939 ACAACATCTAAAATTTATTTGGAGTACCTATGT A 7734646
chr4 108288376 rs373151933 ACAACATCTAAAATTTATTTGGAGTACCTATGT A 7734647

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results