Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 2800265 2805915 enh3847

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 2803068 rs540441174 CGTTCGCAGCCGCCTGTACTCGG C 4263664

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 2802330 2822539 + SRRM2 ENSG00000167978.12 2802330 0.64 1.0 721 14449


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results