Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 109934225 109938375 enh54914

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 109937790 rs542960479 C CTGCAGAAAGGAGCTACCACT 7742283

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results