Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 110793105 110803015 enh21734

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 110797067 rs557280440 CTATCCATGGTGAGACTGCTCCA C 7745583
chr4 110797067 rs70954194 CTATCCATGGTGAGACTGCTCCA C 7745584

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results