Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 111319345 111324675 enh54921

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 111322463 rs71602427 C CTCCTTCCT,CTCCTTCCTTCCTTCCTTCCA 7748467
chr4 111322467 rs533302455 T A,C 7748468

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results