Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 121815185 121825175 enh8171

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 121821651 rs529708742 TATCTGTTCTTCATTGGTTCAA T 7781020

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results