| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr4 | 122924243 | 122928389 | enh45722 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr4 | 122926696 | rs70950868 | GGAGCCACAGCTGCAATTCCCATTAACTGGAA | G | 7785075 | |
| chr4 | 122926696 | rs71902376 | GGAGCCACAGCTGCAATTCCCATTAACTGGAA | G | 7785076 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|