Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 122924243 122928389 enh45722

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 122926696 rs70950868 GGAGCCACAGCTGCAATTCCCATTAACTGGAA G 7785075
chr4 122926696 rs71902376 GGAGCCACAGCTGCAATTCCCATTAACTGGAA G 7785076

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results