Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 123457265 123466315 enh8175

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 123466244 rs538026493 TAAGACATATATACACTTTAACACAGGTAA T 7785808

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results