Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 123629565 123634115 enh65885

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 123629744 rs541562289 G GTAAAATTTTTTTAAATGTCTTC 7786858

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results