Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 123665645 123670495 enh105743

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 123670006 rs11271324 T TACATATATTATCTCGATCTTTGCA 7787095
chr4 123670006 rs370253587 T TACATATATTATCTCGATCTTTGCA 7787096
chr4 123670011 rs558800390 A G 7787097

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results