Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 5550525 5557655 enh3866

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 5552341 rs528408250 GGGACACTGTAAGGGTGGGATGT G 4281933

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results