Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 146609865 146614015 enh93345

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 146613565 rs140787961 GTTCCTGTAGAAGTCAGGAAA G 7862559

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results