Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 146873753 146879715 enh37159

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 146878357 rs573429819 AACACTCATGCTGGCTGCCTT A 7864311

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results