Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 147894385 147898855 enh48887

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 147897102 rs139091224 CCCTTATAAGGCTCTGAGTTG C 7867492
chr4 147897102 rs372932538 CCCTTATAAGGCTCTGAGTTG C 7867493

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results