Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 10577625 10582755 enh16526

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 10582417 rs148601030 GAGAGAGAAGCAGAGAGACAGGCAA G 4307520
chr16 10582417 rs58154903 GAGAGAGAAGCAGAGAGACAGGCAA G 4307521

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results