Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 10897375 10911080 enh60581

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 10910164 rs371141791 TTTGCAGATGTAATTTAATTATTTAATTAAGAA T 4311274
chr16 10910165 rs536391221 TTGCAGATGTAATTTAATTATTTAATTAAGAA T 4311275

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 10854776 10912651 - TVP23A ENSG00000166676.10 10912651 0.87 1.0 2479 14536


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results