-
Home
- TFBS
- SCRT2[chr16:11771443-11771456]
| Chrom |
Start |
End |
Enhancer ID |
Tissues that enhancer appears |
More |
| chr16 |
11770243 |
11777695 |
enh3890 |
|
|
| Chrom |
Position |
dbSNP ID |
Reference Allele |
Alternative Allele |
id |
More |
|
chr16
|
11771453
|
rs140615707
|
GTGGTGAGCTGGTGGCTCTC
|
G
|
4321281
|
|
|
chr16
|
11771453
|
rs8191337
|
GTGGTGAGCTGGTGGCTCTC
|
G
|
4321282
|
|
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
Strand |
Gene Name |
Ensembl ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |
Blank TSI value indicates lack of sufficient expression for calculation
| Chrom |
Start |
End |
strand |
miRNA Name |
miRBase ID |
TSS |
TSI of Normal tissues |
TSI of Cancer tissues |
Distance to TFBS |
id |
More |