Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 11770243 11777695 enh3890

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 11771453 rs140615707 GTGGTGAGCTGGTGGCTCTC G 4321281
chr16 11771453 rs8191337 GTGGTGAGCTGGTGGCTCTC G 4321282

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results